Antimicrobial and Antioxidant Activity: Secondary Metabolite

Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead – drug – molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50±0.01, 32.61±0.06 and 66.54±0.01 respectively.

Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis

The Name “endolichenic fungi” was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows distinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds.

Read also  Automatic Quantification of the Myocardial Extracellular

MATERIALS AND METHODS

Sample Collection

The lichens were collected from Horsley hills (13.66°N 78.40°E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags.

Isolation of Endolichenic Fungi

The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 Ã- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50μg/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28°C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub-cultured on PDA.

Molecular identification of the isolated endolichenic fungus

Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing.

The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) & ITS5 (5′ GGAAGTAAAAGTCGTAACAAGG 3′) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST® (http://www.ncbi.nlm.nih.gov/blast/).

Fermentation and extraction:

The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28±2°C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24].

Read also  Nurse advocacy

Antibacterial Activity:

To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100.

Antifungal activity

The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28°C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 – T2/ T1 X 100.

Screening for Antioxidant activity

DPPH Assay:

Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula

Inhibition Percentage % = [(𝐴blank − 𝐴sample)]/𝐴blank] Ã- 100

Where𝐴blank is the absorbance of the control reaction and 𝐴sample is the absorbance in the presence of purified molecules

Determination of Antioxidant Activity by Reducing Power Measurement

The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50°C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585

September – October 2016 RJPBCS 7(5) Page No. 1415

Inhibition Percentage % = [(𝐴blank − 𝐴sample)]/𝐴blank] Ã- 100

Determination of Nitric Oxide (NO) Scavenging Activity

Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25°C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent.

Read also  Ethical Healthcare Practices in Bangladesh

Inhibition Percentage % = [(𝐴blank − 𝐴sample)]/𝐴blank] Ã- 100.

RESULTS AND DISCUSSION

Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro.

In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens.

1

Fig.1: Lecanora spp of Lichen ISSN: 0975-8585

September – October 2016 RJPBCS 7(5) Page No. 1416

Fig. 2: Isolation of Endolichenic Fungi Fig. 3: Pure culture of Talaromyces tratensis

Fig.4: Antibacterial activity

Fig.5: Antifungal activity

Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I

highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2).

Table. 1: Antibacterial activity of T. tratensis Name of Bacteria

% of growth inhibition at different concentration

25μl

50μl

75μl

100μl

Klebsiella pneumoniae

33.56

57.75

66.63

75.94

Escherichia coli

30.93

56.79

66.75

75.66

Salmonella typhi

30.98

56.32

66.52

74.39

Proteus vulgaris

31.70

55.28

66.00

69.83

Bacillus substiles

31.67

48.06

64.86

72.61

Pseudomonas fluorescence

29.38

49.47

64.95

72.61

Staphylococcus aureus

31.67

48.06

64.86

70.94

Order Now

Order Now

Type of Paper
Subject
Deadline
Number of Pages
(275 words)